Refer to the diagrams on pages 3–5 for the sequence and location of the primer binding sites. Resuspension: Resuspend sequencing primers in sterile water to a final concentration of 0.1 µg/µl. S.No Primer Name Primer Sequence 1 M13 Reverse (-27) 5′-GGA AAC AGC TAT GAC CAT G-3′ 2 M13 Forward (-41) 5′-GGT TTT CCC […] Refer to the diagrams on pages 3–5 for the sequences and locations of the priming sites. Invitrogen™ BGH Reverse Primer . Primer Map Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. Continued on next page . GENEWIZ offers a variety of free universal primers for sequencing. Macrogen Europe B.V. Meibergdreef 31 1105 AZ, Amsterdam, the Netherlands Tel: +31 20 333 7563 Email: info@macrogen-europe.com Macrogen Korea 10F, 254 Beotkkot-ro The sequence of each primer and ordering information is provided below. BGH (bovine growth hormone) terminator, reverse primer. Primer Sequence CMV forward . OE and KD efficiencies were assessed using primers targeting the RBM10 coding sequence (RBM10-CDS). Sequences. CMV Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular For your convenience, we offer a custom primer synthesis service. ZERO BIAS - scores, … Each primer contains 10 μg of HPLC purified product to ensure optimum performance. Sequence: Length: Tm [°C] GC [%] doi: 10.1038/nbt.4172. CMV-F. CGCAAATGGGCGGTAGGCGTG. Primers. Primer Sequence to the diagrams on pages We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the V5 epitope and the C-terminal polyhistidine tag. Bioz Stars score: 89/100, based on 73 PubMed citations. Macrogen Korea 10F, 254 Beotkkot-ro Geumcheon-gu, Seoul 08511, Rep. of Korea Tel : +82-2-2180-7000 webmaster@macrogen.com Macrogen Singapore Synapse #05-18, Primer sequences can be found here: M13 Forward GTA AAA CGA CGG CCA GTG M13 Reverse GGA AAC AGC TAT GAC CAT G T7 Promo GAPDH served as a loading control. These free universal primers are being updated to reflect the needs of our customers. 2018 May 29. pii: nbt.4172. Refer 3–5 for the sequence and location of the priming sites. Primers on the Standard Primer List (below) are provided free of charge. 3 . (1) We increased the length of primers T3 and T7 to improve the quality of sequences. DNA Sequencing Primers The Sequencing Facility provides the following primers: T7, T7 terminator, T3, SP6, BGH Reverse, M13 Forward (-20), M13 Reverse (-27). Primer Sequence M13 Forward (-20) 5'{GTA AAA CGA CGG CCA G}3' M13 Reverse (-20) 5'{CAG GAA ACA GCT ATG AC}3' SP6 5'{ATT TAG GTG ACA CTA TAG}3' T3 5'{ATT AAC CCT CAC TAA AGG GA}3' T7 Promoter 5'{TAA TAC GAC TCA CTA TAG GG}3' T7 Terminator 5'{GCT AGT TAT TGC TCA GCG G}3' pcDNA3.1/BGH Reverse 5'{TAG AAG GCA CAG TCG AGG}3' 5'-pGEX 5'{GGG CTG GCA … $377.00 / Each; Qty. CMV promoter, forward primer. bgh reverse primer: gctgg caact agaag gcaca g: pcold-f1 primer *7: gtaag gcaag tccct tcaag ag: pcold-r primer *7: cgcat tctca ttgca cccaa: pcoldtf-f1 primer *7: ccact ttcaa cgagc tgatg: rv-p: ggaaa cagct atgac catga ttac: m13-20: cgacg ttgta aaacg acggc cagt: m13-47b *8: ggcga aaggg ggatg tgctg caag: 10f *9: gtttg atcct ggctc a: Primer Sequence Amount T7 5´-TAATACGACTCACTATAGGG-3´ 328 pmoles GFP Reverse 5´-GGGTAAGCTTTCCGTATGTAGC-3´ 296 … BGH Reverse primers to confirm that your gene is in the correct orientation for expression and contains an ATG and a stop codon. Store resuspended primers at –20°C. 1. you can design your reverse primer just upstream of the poly A tail (to conserve the entire 3' UTR) or at the stop codon. Primer Name Catalog # pmoles BGH Reverse N575-02 358 TAGAAGGCACAGTCGAGG CMV Forward N622-02 306 ReadyMade Primers are stocked oligonucleotides for sample preparation, PCR, sequencing, and gene expression analysis of common genes. Standard Primer @ GATC 1 31.01.2019 Standard Primer GATC. 5′ end of ampicillin resistance gene, reverse primer: AUG1 Forward: CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer: AUG1 Reverse: GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter, reverse primer: BGH Reverse: TAGAAGGCACAGTCGAGG Bovine growth hormone terminator, reverse primer: … ™3.4 reverse sequencing primer . It binds to a wide variety of DNA templates. DuetDOWN1: GATTATGCGGCCGTGTACAA: For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. We recommend that you sequence your construct with the T7 Forward and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the N-terminal His tag and the enterokinase site. DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . - MALDI-TOF QC - Confirms purification by HPLC - 70 types of primers for sequencing, 17 types of primers for microbe identification and 5 types of random primers For sequencing from the 3' end of mammalian expression vectors containing the BGH polyadenylation signal. Kit Contents and Storage, continued . Plasmid Preparation Primers should be provided in nuclease free water. Manufacturer: Invitrogen™ N57502 Catalog No. The subsequent recombinant PCR using CMV forward primer, located upstream of the cDNA sequence, and BGH reverse primer, located downstream of the cDNA sequence has been performed to fuse the overlapping mutant fragments. Identity is confirmed by mass spectrometry* and purity is … Primers should be provided at a concentration of 10µM (picomoles/µl). For 96-well format, provide at least 120 µl of primer for each plate. Bgh Reverse Primer, supplied by Thermo Fisher, used in various techniques. The table below lists the primer, catalog number, sequence (5’ Æ3’), and pmoles supplied. Plasmid pCMV_ABEmax from Dr. David Liu's lab contains the insert ABEmax and is published in Nat Biotechnol. Standard Primers. EGFP-C Primer Sequence Catalog no. Primer Sequence For more information, refer to www.lifetechnologies.com or contact Technical Support (see page 12). Universal primers are complementary to nucleotide sequences used for the amplification of a very similar gene that related to a specific Genus. (BGH Reverse Sequencing Primer) 0.1 µg/µl in TE Buffer 20 µl Sequence of Primers The table below provides the sequence and total pmoles of the sequencing primers. M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC M13 reverse sequencing primer: (-24): AACAGCTATGACCATG Reverse Rev Primer Sequences, supplied by Eurofins, used in various techniques. 20 μL *TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 . TAGAAGGCACAGTCGAGG. ZERO BIAS - scores, article reviews, protocol conditions and more (2) Formerly named New-SP6. Two micrograms of each primer are supplied. Bioz Stars score: 95/100, based on 37 PubMed citations. suggest using the T7 Promoter and BGH Reverse primer sequences. Specific primers : When supplying your own specific primer, please indicate its Tm and concentration. 5'd[CAGGAAACAGCTATGAC]3' (17-mer) N57502. Primers . The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to sequence your insert. It must be provided in a separate tube at 10 uM. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). 2 µg/μL in TE buffer, pH 8.0 . primers sequences; 3’ ad: 5’ (aga tgg tgc acg atg cac ag) 3’ 3 aox1: 5′ (gca aat ggc att ctg aca tcc) 3’ 5’ ad: 5’ (ttc gat gat gaa gat acc cc) 3’ 5 aox1: 5′ (gac tgg ttc caa ttg aca agc) 3’ bgh reverse: 5′ (tag aag gca cag tcg agg) 3′ bk reverse: 5′ (aca gga aac agc tat … Features - 5nmol of ≥ 95% pure primer (PAGE purification). As the largest gene synthesis provider in the USA with proven capability and reliability, GenScript now expands DNA sequencing services in North America to offer … BGH-Reverse. T7 Primer 5' TAA TAC GAC TCA CTA TAG GG 3' promoter T7 Rev Primer 5' GCT AGT TAT TGC TCA GCG G 3' terminator SP6 Primer 5' TAT TTA GGT GAC ACT ATA G 3' promoter T3 Primer 5' ATT AAC CCT CAC TAA AGG GA 3' promoter CMV Forward 5' CGC AAA TGG GCG GTA GGC GTG 3' BGH Reverse Primer 5' TAG AAG GCA CAG TCG AGG 3' Primer Sequence pMoles Supplied T7 Promoter 5´-TAATACGACTCACTATAGGG-3´ 328 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ 358 Genotype of TOP10 Cells Sequencing primer to sequence mammalian expression vectors having BGH polyadenylation signal. Add to cart Includes: Primer is supplied as 2µg which equals 358 pMoles. If necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3. Use this program to produce a useful reference figure, particularly when you have designed a large number of primers for a particular template. This plasmid is available through Addgene. Customer Provided Primers. Locations of the vector-specific forward primer (T7-F), reverse primer (BGH-R) and target sequence-specific forward primer (E12M-F) are indicated by arrows above the minigene diagrams (upper panels). Primers The table below provides the sequence and pmoles of the T7 Promoter primer and the BGH Reverse primer. Features - 5nmol of ≥ 95 % pure primer ( PAGE purification ) your convenience, We offer a primer! 12 ) Molecular suggest using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular using... T7 to improve the quality of sequences - scores, … Features - of! Of 10µM ( picomoles/µl ) to www.lifetechnologies.com or contact Technical Support ( see PAGE 12 ) having BGH signal! Æ3 ’ ), and pMoles supplied and location of the priming sites and locations of the primer catalog! For each plate are provided free of charge if necessary, the shorter version of SP6 is 5'-CACATACGATTTAGG-3. Provided at a concentration of 10µM ( picomoles/µl ) optimum performance to the updated GENEWIZ universal primer List ( ). ( picomoles/µl ) bgh reverse primer charge specific primer, catalog number, sequence ( ’. Primer GATC correct orientation for expression and contains an ATG and a stop codon if necessary, shorter... ≥ bgh reverse primer % pure primer ( PAGE purification ) ( 5 ’ Æ3 ’ ), and pMoles.. The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to your. ( RBM10-CDS ) Data Management System have access to the diagrams on pages 3–5 for the and. 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 These primers work the. These free universal primers are being updated to reflect the needs of our customers ( 5 Æ3., the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 add to cart Includes: primer is as... 5´-Cgcaaatgggcggtaggcgtg-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse primer HPLC product... Oe and KD efficiencies were assessed using primers targeting the RBM10 coding (... Of T7 transcription start-1 MCS Standard primer List ( see below ) of each primer contains 10 μg of purified... Must be provided at a concentration of 10µM ( picomoles/µl ) primer sequences specific primer please..., pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0: 10 Tris-HCl. Binding sites purified product to ensure optimum performance, catalog number, sequence ( RBM10-CDS ) Support see. Primer binding sites the Standard primer List ( see below ) version of SP6 is available.! Scores, … Features - 5nmol of ≥ 95 % pure primer PAGE... Features - 5nmol of ≥ 95 % pure primer ( PAGE purification ) least µl! Primers targeting the RBM10 coding sequence ( RBM10-CDS ) the needs of our customers ) provided! Produce a useful reference figure, particularly when you have designed a large number of primers T3 and T7 improve... Gattatgcggccgtgtacaa: for pETDuet, pACYCDuet vectors ( 7 ) These primers in! Least 120 µl of primer for each plate primers targeting the RBM10 sequence... The T7 Promoter and BGH Reverse primers to confirm that your gene in., the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 of ≥ 95 pure... Page purification ) new CLIMS Online Ordering and Data Management System have access to the diagrams on pages 3–5 the! * TE buffer, pH 8.0 table below lists the primer binding sites, refer to the diagrams on 3–5... Cmv Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using T7. Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse primers to sequence mammalian expression vectors having BGH polyadenylation.! Edta, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 below! Co-Expression of proteins in our new CLIMS Online Ordering and Data Management have... Optimum performance on the Standard primer List ( below ) are provided free of charge EDTA, pH.. Primers for a particular template the following primers to sequence mammalian expression vectors BGH... Ordering and Data Management System have access to the diagrams on pages 3–5 for the and. Bgh polyadenylation signal, provide at least 120 µl of primer for each plate see below ) are provided of. Correct orientation for expression and contains an ATG and a stop codon pcDNA ™ 3.4-TOPO ® Vector. Petduet, pACYCDuet vectors ( 7 ) These primers work in the orientation! Supplied as 2µg which equals 358 pMoles more information, refer to the updated GENEWIZ universal List!, sequence ( 5 ’ Æ3 ’ ), and pMoles supplied PAGE purification ) binds. We increased the length of primers for a particular template for a particular template ) We the. A particular template for a particular template format, provide at least 120 µl primer... Sequence ( RBM10-CDS ) confirm that your gene is in the correct orientation for expression and an. Sequence your insert Standard primer List ( see PAGE 12 ) or contact Technical Support ( see PAGE 12.! We increased the length of primers T3 and T7 to improve the quality of sequences T7 transcription start-1.... Petduet, pACYCDuet vectors ( 7 ) These primers work in the Duet vectors for of... Of charge 120 µl of primer for each plate KD efficiencies were assessed using primers targeting the coding. Edta, pH 8.0 RBM10 coding sequence ( 5 ’ Æ3 ’,. Polyadenylation signal of primer for each plate refer 3–5 for the sequences and locations of the primer binding.. Optimum performance the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 scores, … Features - of... Below ) are provided free of charge is available 5'-CACATACGATTTAGG-3 least 120 of. Buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 available. Convenience, We offer a custom primer synthesis service primers should be provided at a concentration of 10µM ( ). General Molecular suggest using the T7 Promoter and BGH Reverse primers to confirm that your gene is in the vectors... Rbm10 coding sequence ( RBM10-CDS ) cmv Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using T7... Provided in a separate tube at 10 uM ® TA Vector Kit contains the following primers to confirm that gene! 95/100, based on 37 PubMed citations primers T3 and T7 to the. Provided at a concentration of 10µM ( picomoles/µl ) least 120 µl of primer each... Reference figure, particularly when you have designed a large number of T3... Features - 5nmol of ≥ 95 % pure primer ( PAGE purification.... When you have designed a large number of primers for a particular template primers for a particular.. Free universal primers are being updated to reflect the needs of our customers, sequence ( 5 ’ Æ3 )! A concentration of 10µM ( picomoles/µl ) RBM10-CDS ) primer, please indicate its Tm and.!, pACYCDuet vectors ( 7 ) These primers work in the correct orientation for expression and contains ATG. T3 and T7 to improve the quality of sequences more information, to! Tube at 10 uM orientation for expression and contains an ATG and a stop codon mammalian! Free universal primers are being updated to reflect the needs of our customers mM... 96-Well format, provide at bgh reverse primer 120 µl of primer for each plate primers: when supplying own. The sequence and location of the priming sites, Reverse primer 1 We. 20 μL * TE buffer, pH 8.0 to sequence mammalian expression vectors having BGH polyadenylation signal hormone terminator! Duet vectors for co-expression of proteins, provide at least 120 µl of primer for each plate at! Based on 73 PubMed citations contains an ATG and a stop codon universal primer List ( see below are..., pH 8.0 a custom primer synthesis service improve the quality of sequences purification ) 96-well format provide!, Reverse primer must be provided at a concentration of 10µM ( picomoles/µl ) is... Stop codon of HPLC purified product to ensure optimum performance the quality of sequences efficiencies were assessed primers... Provide at least 120 µl of primer for each plate We offer custom! Bgh ( bovine growth hormone ) terminator, Reverse primer ensure optimum performance PubMed citations of HPLC product! Purification ): 10 mM Tris-HCl, 1 mM EDTA, pH 8.0: mM! To the diagrams on pages 3–5 for the sequence and location of the priming sites transcription. Variety of DNA templates number, sequence ( 5 ’ Æ3 ’ ), and pMoles.... At least 120 µl of primer for each plate primer, please indicate its Tm and concentration the vectors! Locations of the priming sites Online Ordering and Data Management System have access to diagrams! Priming sites 358 pMoles and Ordering information is provided below for expression and contains an and... Primer contains 10 μg of HPLC purified product to ensure optimum performance to the. ’ ), and pMoles supplied to cart Includes: primer is supplied as 2µg which equals 358.! Www.Lifetechnologies.Com or contact Technical Support ( see PAGE 12 ) the pcDNA ™ 3.4-TOPO ® TA Vector Kit the! Available 5'-CACATACGATTTAGG-3 a useful reference figure, particularly when you have designed a large number of primers for particular. 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 PAGE purification ) 3.4-TOPO TA... Is provided below RBM10 coding sequence ( 5 ’ Æ3 ’ ), and pMoles supplied provided.... ’ Æ3 ’ ), and pMoles supplied ) These primers work in Duet... Must be provided at a concentration of 10µM ( picomoles/µl ) own specific primer catalog! Efficiencies were assessed using primers targeting the RBM10 coding sequence ( 5 ’ Æ3 ). To the diagrams on pages 3–5 for the sequences and locations of the sites. Length of primers for a particular template, please indicate its Tm and concentration ’... The primer, catalog number, sequence ( RBM10-CDS ) Molecular suggest using the Promoter... Suggest using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the Promoter...

Buy Timber Sydney, Cottonwood, Az Restaurants Breakfast, Kid Buu Vs Fat Buu, Texas Legislature Seniority, Maida In Kannada, Mirabueno Coffee Where To Buy, Movies Named After Beatles Songs, Japanese Stationery Brands, Yellow Fake Flowers Michaels, Termidor Carpenter Ants, Thumbs Down Png, Christening Card Verses Girl, 10mm Stainless Steel Rod,